-
Notifications
You must be signed in to change notification settings - Fork 41
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
IMP: Do no allow duplicate records in DNAFASTAFormat (#220)
- Loading branch information
1 parent
cf45830
commit e046b9a
Showing
5 changed files
with
52 additions
and
6 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
5 changes: 5 additions & 0 deletions
5
q2_types/feature_data/tests/data/dna-sequences-duplicate-id.fasta
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
>SEQUENCE1 | ||
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT | ||
>SEQUENCE1 | ||
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT | ||
ACGTACGTACGTACGTACGTACGT |
1 change: 1 addition & 0 deletions
1
q2_types/feature_data/tests/data/dna-sequences-id-starts-with-space.fasta
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
> this_id_starts_with_a_space |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
> |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters